13 - Loops III - controlling and nesting.ipynb

Kernel: Python 3 (system-wide)

Exercise 13.1

Loop through the following DNA sequences. Stop when you find the first sequence starting with "TATA" and print that sequence.

• Hint 1: break out of the loop.

• Hint 2: Use string slicing to access the first four bases of each DNA sequence.

dna_sequences = ['TATCATGGTATAGGATGAT', 'CTATAGCCTATATATTAGGA', 'TATATCGCTAGGGTATAGGGTT', 'TATGAGGATTAGA', 'TATAGACTAGGAT']

for seq in dna_sequences:
    if seq[:4] == 'TATA':
        print(seq)
        break

Exercise 13.2

Count how many of the three stop codons "TAA", "TAG" and "TGA" occur in each of the following DNA sequences in the list dna_sequences. Ignore multiple occurrences of the same stop codon in a DNA sequence.

• Hint: You will need a nested loop: An outer loop to go through the sequences and a nested loop to go through the stop codons.

dna_sequences = ['TATCATGGTATAGGATGAT', 'CTATAGCCTATATATTAGGA', 'TATATCGCTAGGGTATAGGGTT', 'TATGAGGATTAGA', 'TATAGACTAGGAT']

stop_codons = ['TAA', 'TAG', 'TGA']

for seq in dna_sequences:
    count = 0

    for codon in stop_codons:
        if codon in seq:
            count += 1

    if count == 1:
        print( f'{count} of the stop codons is in {seq}' )
    else:
        print( f'{count} of the stop codons are in {seq}' )