13 - Loops III - controlling and nesting.ipynb

Kernel: Python 3 (system-wide)

Exercise 13.1

Loop through the following DNA sequences. Stop when you find the first sequence starting with "TATA" and print that sequence.

• Hint 1: break out of the loop.

• Hint 2: Use string slicing to access the first four bases of each DNA sequence.

dna_sequences = ['TATCATGGTATAGGATGAT', 'CTATAGCCTATATATTAGGA', 'TATATCGCTAGGGTATAGGGTT', 'TATGAGGATTAGA', 'TATAGACTAGGAT']


for i in dna_sequences:
    
    if i[0:4] == 'TATA':
        print(i)
        break

TATATCGCTAGGGTATAGGGTT

Exercise 13.2

Count how many of the three stop codons "TAA", "TAG" and "TGA" occur in each of the following DNA sequences in the list dna_sequences. Ignore multiple occurrences of the same stop codon in a DNA sequence.

• Hint: You will need a nested loop: An outer loop to go through the sequences and a nested loop to go through the stop codons.

dna_sequences = ['TATCATGGTATAGGATGAT', 'CTATAGCCTATATATTAGGA', 'TATATCGCTAGGGTATAGGGTT', 'TATGAGGATTAGA', 'TATAGACTAGGAT']

stop_codons = ['TAA', 'TAG', 'TGA']


for dna_seq in dna_sequences:
    
    count = 0
    
    for codons in stop_codons:
        

        if codons in dna_seq:
            print(f'{codons} is present')
            count += 1    
        
        else:
            print(f'{codons} not present')
            
    print(f'{count} stop codons are present in {dna_seq}')
            
    print()

TAA not present
TAG is present
TGA is present
2 stop codons are present in TATCATGGTATAGGATGAT

TAA not present
TAG is present
TGA not present
1 stop codons are present in CTATAGCCTATATATTAGGA

TAA not present
TAG is present
TGA not present
1 stop codons are present in TATATCGCTAGGGTATAGGGTT

TAA not present
TAG is present
TGA is present
2 stop codons are present in TATGAGGATTAGA

TAA not present
TAG is present
TGA not present
1 stop codons are present in TATAGACTAGGAT