Background
During the last decade several genes have been found to
be interrupted by selfish genetic elements translated in
frame with their host proteins. During post translational
processing these elements excise themselves out of the host
protein (see [ 1 ] and [ 2 ] for recent reviews). The
sequences removed during splicing are called inteins (short
for internal protein); the portions of the host protein are
termed exteins (external protein) [ 3 4 5 ] .
Inteins facilitate their excision out of the host
protein without the help of any known host specific
activity. This phenomenon, called protein splicing, was
first discovered about a decade ago in the
Saccharomyces cerevisiae V-ATPase
catalytic subunit A [ 6 7 ] . Intein excision depends on
the splicing domain of the intein and the first amino acid
residue of the C-extein [ 8 ] . The inteins known to date
are between 134 and 608 amino acids long, and they have
been reported from all three domains of life: eukaryotes,
eubacteria and archaea. Pietrokovski's webpage on inteins
http://blocks.fhcrc.org/~pietro/inteins/currently lists
more than 100 inteins in 34 different types of proteins [ 9
] . The host proteins are diverse in function, including
metabolic enzymes, DNA and RNA polymerases, gyrases,
proteases, ribonucleotide reductases, and vacuolar and
archaeal type ATPases. Common features suggested for these
proteins are their expression during DNA replication [ 1 ]
and their low substitution rate during evolution [ 9 ]
.
Most reported inteins are composed of two domains: one
is responsible for protein splicing, and the other has
endonuclease activity [ 10 11 12 13 ] . The function of the
endonuclease is to spread the intein to intein-free
homologs of the host protein. During this process, called
homing, the gene encoding the intein-free homolog is
cleaved by the endonuclease at or close to the intein
integration site. During the repair of the cleaved gene,
the intein is copied to the previously intein-free homolog.
Gimble and Thorner [ 14 ] demonstrated intein homing in
Saccharomyces cerevisiae using
engineered V-ATPase genes from which the intein encoding
portion had been previously removed. However, some inteins
lack the endonuclease domain. Inteins without this domain
perform autocatalytic splicing [ 15 16 ] . Homing
endonucleases and the process of homing have been more
intensively studied in self splicing introns [ 17 ] , and
the process is assumed to be similar for inteins.
Thermoplasma acidophilum is among
sixteen archaea for which inteins have been reported to
date (Intein database
http://www.neb.com/inteins/int_reg.html [ 18 ] ). Members
of the genus
Thermoplasma lack cell walls and
possess a cytoskeleton. They live in hot and acidic
environments, and are often found adhering to sulfur
particles [ 19 ] .
T. acidophilum grows optimally at
59°C and at an external pH between 1-2 [ 20 ] . A
cytoplasmic pH of 5.5 has been measured indirectly [ 21 ]
.
Proton pumping ATPases/ATPsynthases are found in all
groups of present day organisms [ 22 ] . The typical
archaeal ATPsynthase is homologous to the eukaryotic
vacuolar ATPase. Because of the high degree of sequence
similarity the archaeal ATP synthase (A-type ATPase) is
sometimes labeled as vacuolar or V-type ATPase. The
archaeal and the vacuolar ATPase are both homologous to the
bacterial F-ATPases, but the level of sequence similarity
with the F-ATPases is much lower than between the V- and
the A-ATPases. To date seven species have been identified
to harbor inteins in their ATPase catalytic subunits. The
first intein was discovered in the
vma -1 gene of
Saccharomyces [ 7 ] . The yeast
Candida tropicalis [ 23 ] possesses
an intein in the same location. Inteins are also present in
the A subunit of the A-type ATPases of
Thermoplasma acidophilum, T. volcanium,
Pyrococcus abysii, P. horikoshii and
P. furiosus.
Here we present data on the cloning and expression of
the
T. acidophilum A-ATPase A subunit in
E. coli, and we discuss implications
for the location, propagation and distribution of inteins
among organisms.
Results
Sequence analysis of the T.
acidophilumintein
The
T. acidophilum intein was
discovered while sequencing the catalytic subunit of the
archaeal ATPase/ATPsynthase from
T. acidophilum for systematic
purposes [ 24 ] . More recently, the complete genome
sequences of
T. acidophilum [ 25 ] and
T. volcanii [ 26 ] have been
reported. In both instances, the catalytic subunit of the
ATPsynthase is the only gene in the entire genome for
which an intein was reported. Using PSI-BLAST [ 27 ] with
different inteins as seeds, divergent inteins with less
than ten percent sequence identity as compared to the
query sequence are recovered (data not shown); however,
using this approach we did not discover any additional
intein or homing endonuclease encoding genes in
T. acidophilum.
Multiple sequence alignments of diverse intein
sequences identified eight motifs composed of moderately
conserved residues [ 18 28 ] . The A-ATPase A subunit of
the
Thermoplasma and
Pyrococcus intein multiple sequence
alignment (with manual modification) is shown in figure
1. The
T. acidophilum intein (173 amino
acids long) is among the shortest inteins known, and the
alignment with other inteins reveals the absence of
sequences homologous to the typical endonuclease motifs.
Only the motifs characteristic for the self splicing
domain are present in the
Thermoplasma intein (see figure
1).
The significance of the match between the
T. acidophilum and the three
pyrococcal ATPase inteins was assessed using PRSS at
http://fasta.bioch.virginia.edu/fasta/prss.htm [ 29 ] .
The P-value for this match, i.e. the probability of
obtaining a match of this quality by chance alone, was
calculated to be below 10 -10. This indicates that not
only the exteins, but also the inteins themselves are
recognizably homologous. In contrast, a sequence
alignment of all known inteins shows intein sequences to
be much more divergent (not shown). For example, the
P-value for the comparison between the
T. acidophilum and the
Saccharomyces cerevisiae intein was
0.28, i.e. no significant similarity between the yeast
and the
Thermoplasma inteins was detectable
using pairwise alignments only.
Location of the intein within the host
protein
The vacuolar and the archaeal ATPases are homologous
to the bacterial and organellar F-type ATPases. The
structure of the bovine mitochondrial F
1 -ATPase has been determined by X-ray
crystallography [ 30 ] . The intein insertion points in
the yeasts' V-ATPase and the
Thermoplasma and
Pyrococcus A-ATPases correspond to
the catalytic site where the ATP binds and is hydrolyzed
during the catalytic cycle. Figure 2shows that the
inteins are located in the regions of these very
conserved proteins [ 22 ] that have the lowest
substitution rates.
Comparison of A-ATPase catalytic subunit and 16S
rRNA phylogeny
The phylogenies of archaeal ATPase catalytic subunits
and small subunit ribosomal RNAs are shown in Figure 3.
Both phylogenies were calculated for a similar set of
species. While the two phylogenies show some significant
differences, neither of them groups the molecules from
Thermoplasma with the
Pyrococcus homologs. In both
phylogenies several other Archaea, i.e.,
M. jannaschii, M. thermolithotrophicus,
Thermococcus sp., Halobacterium sp.,
Methanosarcina and
Methanobacterium
thermoautotrophicus branch off between the two groups
that carry inteins in their ATPase catalytic subunits.
All of these intervening archaeal ATPases do not carry an
intein.
Codon usage comparison
Codon usage varies among organisms. The production of
tRNAs corresponds to the frequencies with which the
different codons are present in their protein coding
genes. The exact causes for tRNA regulation and codon
usage are not completely understood; however, expression
of foreign genes in an organism is often prevented by a
different codon usage of the foreign gene [ 31 ] . Many
Archaea have codon usage frequencies and tRNA
compositions different from
E. coli. The
T. acidophilum A-ATPase A subunit
has 763 codons. Codon AUA (Ile) is the most frequent
(39/1000). In
E. coli the same codon (AUA) is a
rare codon present at a frequency of only 5.5 per 1000.
The other two major differences in codon usage between
the
T. acidophilum A-ATPase A subunit
and
E. coli are AGG (Arg) and AGA (Arg)
which are present in
T. acidophilum A-ATPase A subunit
at frequencies of 41 and 16 per 1000 respectively. In
E. coli however, these codons are
considered rare and occur with frequencies of 1.7 and 2.8
per 1000 respectively.
Expression and intein splicing of T.
acidophilumA-ATPase A subunit
The gene encoding the
T. acidophilum A-ATPase A subunit
was cloned into the expression vector pET-11a
(Stratagene) and transformed into
E. coli Bl21(DE3) and
E. coli Bl21-CodonPlus(DE3)-RIL
strain for protein expression. When
E. coli Bl21(DE3), a strain that
did not express additional rare tRNAs, was transformed
with the cloned
T. acidophilum ATPase A subunit, no
additional protein bands were observed in extracts of
induced cells (not shown). However, the
E. coli Bl21-CodonPlus (DE3)-RIL
strain transformed with the same plasmid expresses two
additional proteins of 20 and 65 kDalton upon induction
(Fig. 4). No additional band at 85 kDa, indicative of an
unprocessed intein, was visible after induction. This
demonstrates that autocatalytic splicing occurred
efficiently in
E. coli. Efficient autocatalytic
splicing was also observed when the
E. coli were grown and induced at
42°C, or when the
E. coli were induced at 16°C for 16
hours (Fig. 4A). During preparation for SDS gel
electrophoreses the samples are heated to 72°C in the
presence of DTT. With respect to temperature these
conditions are more similar to the conditions in the
T. acidophilum cytoplasm than the
conditions in
E. coli. Intein excision might
occur only during this high temperature treatment.
Therefore, proteins from induced
E. coli were also separated under
non-denaturing conditions with or without addition of
DTT. The induced bands were excised from the
non-denaturating gel and separated using denaturing SDS
gel electrophoresis (Fig. 5). Both of the slower
migrating bands visible after induction (A and B in Fig.
5), revealed only one major band corresponding to the
spliced and religated A-subunit upon separation in an SDS
denaturing gel. Presumably the slower migrating band was
a dimer or higher aggregate of the A-subunit monomer. In
none of these experiments did we find any indications for
unprocessed or incompletely spliced inteins.
Discussion
The
Daucus carota [ 32 ] and
Saccharomyces cerevisiae (Alireza
Senejani unpublished) catalytic V-ATPase subunits form
inclusion bodies when expressed in
E. coli. In contrast, the
T. acidophilum subunit is expressed
as a soluble protein in the
E. coli cytoplasm. Despite the
chemical and physical differences between the
E. coli cytoplasm and the environment
in which the
T. acidophilum intein is functioning
in vivo, we found no indications that
self-splicing of the intein was inefficient in
E. coli. Even when
E. coli was grown at lower
temperatures, processing of the intein and religation of
the exteins appeared 100% efficient. Complete processing
was also observed when the
E. coli proteins were separated in
non-denaturing and non-reducing gels. Autocatalytic
splicing of the
T. acidophilum A-ATPase catalytic
subunit occurs efficiently in the
E. coli cytoplasm. The
T. acidophilum A-ATPase intein
appears to splice out efficiently at very different pHs
(7.2 versus 5.5 [ 21 33 ] ) and temperatures (16 to 37°
versus 55°C [ 20 ] ).
The
T. acidophilum intein shows
significant sequence similarity to the inteins found in the
A-ATPase catalytic subunits of
Pyrococcus. Moreover, these inteins
are inserted into the same highly conserved sequence in the
ATP binding site. This indicates that the inteins in
Thermoplasma and
Pyrococcus are homologous in the
evolutionary sense,
i.e., they are derived from a common
ancestral gene. However,
Pyrococcus and
Thermoplasma are not considered
closely related Archaea. Based on their 16S rRNA they are
considered distantly related Euryarchaeotes (See Fig.
3b).
One explanation for the discrepancy between phylogenetic
classification and distribution of the A-ATPase intein is
horizontal gene transfer: the intein was not present in the
last common ancestor of
Thermoplasma and
Pyrococcus, rather the intein invaded
one of the lineages after their split and was more recently
horizontally transferred to the other lineage. The
horizontal transfer scenario is more parsimonious than the
assumption of presence in the shared common ancestor
because the latter requires several independently occurring
losses of the intein together with its long-term
persistence in the
Pyrococcus and
Thermoplasma lineages (
cf. Fig. 3b). Horizontal transfer of
whole genes and operons between divergent species is a
frequent event [ 34 35 36 37 ] . Even house keeping genes
are transferred between divergent species [ 37 ] .
Two possibilities exist for the horizontal transfer
scenario. Either the whole A-ATPase catalytic subunits was
transferred, or the intein alone spread as a selfish
genetic element. To discriminate between these two
scenarios, we constructed the phylogeny of the host protein
(Fig. 3a). The resulting phylogeny is in reasonable
agreement with the ribosomal rRNA phylogeny, the main
exception being the placement of
Desulfurococcus. According to its 16S
rRNA this organisms is clearly classified as a
Crenarcheote; however, its ATPase catalytic subunit groups
with
Thermococcus sp. The finding that the
host protein itself does not group the genus
Thermoplasma with the
Pyrococci suggests that the intein
alone was transferred between
Thermoplasma and
Pyrococcus, and that the sequence
similarity between the
Thermoplasma and
Pyrococcus catalytic subunits was
sufficient to allow homing into the same insertion
site.
The dispersion of the intein as a selfish genetic
element is consistent with the work of Goddard and Burt [
38 ] on the persistence of an intron with homing
endonuclease in yeast mitochondria. These authors studied
the distribution of empty target sites, and introns with
and without a functioning endonuclease gene among different
yeasts. They concluded that the long term persistence of
the intron depends on a cycle that begins with invasion of
the empty target site by an intron with the help of a
homing endonuclease encoded by an open reading frame within
the intron. However, once the intron containing allele is
fixed in the population, the endonuclease, which itself had
been the reason for the rapid spread of the intron in the
population, is no longer under selection, the endonuclease
becomes non-functional and is lost, resulting in an intron
without homing endonuclease activity. However, once the
endonuclease is lost the intron containing allele becomes
more likely to be replaced with an allele that has lost the
intron altogether and the cycle of invasion and successive
loss begins anew.
The process of intein homing is likely to depend on a
similar cycle; however, the time intervals for loss of the
intein are likely to be longer than the loss of the intron.
The A-ATPase and the V-ATPase inteins are located in the
most conserved part of the host gene. Any deletion of the
intein from the gene itself needs to be precise, because
any alteration of the amino acid sequence in the catalytic
site is likely to result in a non-functioning enzyme.
Comparative sequence analysis (Fig. 1) shows that the
T. acidophilum and
T. volcanium inteins do not contain
an endonuclease domain. Our search of the genomes of these
Archaea did not identify any endonucleases that might
function in homing. While the failure to identify a homing
endonuclease is not proof of absence, the presence of a
homing endonuclease acting in trans would be unprecedented
and has to be regarded as improbable. The cyclic reinvasion
model for long term persistence of a selfish genetic
element through homing [ 38 ] suggests that the small
Thermoplasma intein evolved through
reduction from a large endonuclease containing intein
similar to the one found in the pyrococcal A-ATPase.
Apparently, the small intein has been persisting in the
Thermoplasma A-ATPase since the split
between
T. acidophilum and
T. volcanium without the help of a
homing endonuclease.
The cyclic reinvasion model also explains why the
insertion site is in a region of very low substitution
rates: The high degree of sequence similarity surrounding
the integration point facilitates the intein transfer
between different populations and species using the homing
endonuclease. A more variable sequence surrounding the
integration point would restrict homing to members of the
same species, and would thus lower the chances for long
term survival of the intein.
Conclusion
The small intein in the
Thermoplasma A-ATPase is closely
related to the endonuclease containing intein in the
Pyrococcus A-ATPase. Phylogenies
constructed with the host protein (A-ATPase catalytic
subunit) and with 16S rRNA do not group these two organisms
together, suggesting that the A-ATPase intein spread
through horizontal gene transfer. The small intein has
persisted in
Thermoplasma apparently without
homing. The
T. acidophilum intein retains
efficient self-splicing activity when expressed in
E. coli. This activity does not
depend on the physicochemical conditions in the
T. acidophilum cytoplasm.
Materials and Methods
Plasmid constructs
The
T. acidophilum A-ATPase A subunit
encoding gene was amplified from genomic DNA using
primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5
(GAGGTGAACATATGGGAAAGATAATCAG). These primers match the
coding sequence of the
Thermoplasma acidophilum A-ATPase A
subunit (gene identification number 9369337) and
introduce restriction sites useful in subcloning.
Initially, the PCR product was cloned into pCR R2.1 (TA
cloning Vector, Invitrogen). After digestion with
Nde I and
BamH I the coding sequence was
subcloned to the vector pET-11a (Stratagene) for gene
expression experiments.
Protein expression and determination
E. coli Bl21(DE3) and
Bl21-CodonPlus(DE3)-RIL strain (Stratagene) were used for
protein expression. If not stated otherwise, transformed
E. coli were grown overnight in a
culture wheel at 37°C in Luria-Bertani broth with
ampicillin (100 μg/mL). One mL of the broth was used to
inoculate 10 mL of LB broth containing ampicillin and
incubated at 37°C (200 rpm). After 2 hours, isopropyl
thio-β-D-galactoside (IPTG) was added to a final
concentration of 1 mM to induce gene expression and the
cultures. Cells were harvested 4 hours after induction by
centrifugation at 7000 rpm for 10 min and washed with TEP
buffer (0.1 M Tris-HCl, pH 7.4, 0.01 M EDTA and 1 mM
phenyl methyl sulfonyl fluoride). Cells were resuspended
in 500 μL of TEP buffer and sonicated with a Braun-Sonic
U with micro-tip for 4 minutes (0.5 duty cycle; power
output approximately 120). The disrupted cells were
centrifuged at 8000 rpm and the pellet was resuspended in
500 μL of fresh TEP buffer. Both the supernatant and the
pellet were diluted by adding 6X sample buffer (10% SDS,
1.2 mg/mL bromphenol blue, 0.6 M DTT, 30% glycerol, .1 M
Tris/HCl pH 6.8) and heated to 80°C for 15 minutes to
denature the protein. Five to fifty microliters of this
preparation were run in a 10% denaturing Tris/Tricine SDS
polyacrylamide gel electrophoresis system as described by
Schagger and von Jagow [ 42 ] .
Non-denatured protein was prepared with the same
procedure except that SDS was omitted from the buffers
and that the samples were not heated. Proteins were
electroeluted from the non-denaturing gel as describe
here [ 24 ] . Gels were fixed with fixing solution (50%
methanol, 10% acetic acid) for 15 minutes, followed by
staining in Coomassie staining solution (20% acetic acid,
0.025% Coomassie blue G-250) for one hour, followed by
destaining in destaining solution (5% methanol, 10%
acetic acid) [ 42 ] .
DNA sequencing and cloning
DNA was sequenced using the ABI PRISM BigDye
Terminator Cycle Sequencing (PE Applied Biosystems).
Sequencing gels were ran and processed in the Biotech
Center (University of Connecticut)
Codon usage
The program Codon Usage Tabulated from GenBank (CUTG)
at http://www.kazusa.or.jp/codon/ [ 43 ] was used to
calculate the codon usage of individual genes and
genomes.
Sequence retrieval, alignment and phylogenetic
reconstruction
The
Pyrococcus furiosus A-ATPase
sequence was retrieved via blastp from the unfinished
genome using the web page
http://combdna.umbi.umd.edu/bags.html. The aligned small
subunit ribosomal RNA sequences were retrieved from the
Ribosomal Database Project II http://rdp.cme.msu.edu [ 44
] . Francine Perler (New England Biolabs) the curator of
the intein database
http://www.neb.com/inteins/int_reg.htmlkindly provided
the sequences of all known inteins. All the other
sequences were retrieved from the NCBI databank.
Sequences were aligned using CLUSTAL X 1.8 [ 45 ] .
The number of substitutions per site in the aligned data
set were calculated using a JAVA program written by Olga
Zhaxybayeva (University of Connecticut). This program
calculates and plots the number of substitutions in a
sliding window of 10 aligned positions. The window is
moved through the alignment one position at a time. For
positions where less than 50% of the sequences have a
gap, the average number of substitutions was calculated
considering the gap as an additional character. Positions
with gaps in more than 50% of the aligned sequences were
skipped.
Phylogenies were reconstructed from amino acid
sequences aligned using CLUSTAL X 1.8 [ 45 ] . The
topologies of the depicted trees were calculated using
neighbor joining as implemented in CLUSTAL X with
correction for multiple substitutions. Branch lengths and
their confidence intervals were calculated with
TREE-PUZZLE 5.0 [ 46 ] using the JTT or the HKY model for
substitution respectively, and assuming an among site
rate variation described by a gamma distribution.
Bootstrap samples were analyzed using parsimony as
implemented in PAUP* 4.0 beta 8 [ 47 ] treating gaps as
missing data. Each bootstrapped sample was analyzed using
10 different starting trees built through random
addition, tree-branch-reconnection (TBR) branch swapping,
and considering gaps as missing data. The following
sequences were used for the 16S rRNA phylogeny (the
sequences are available under these names from the
Ribosomal Database Project II http://rdp.cme.msu.edu/:
Sul.solfa4, Sul.acalda, Ap.pernixl, Mc.thlitho,
Mc.janrrnA, Mb.tautot2, Pc.furios2, Pc.abyssi, AP000001,
AB016298, Tpl.acidop, Arg.fulgid p, Hf.volcani,
Hb.spCh2_2, Hb.salina2, Msr.mazei5, Msr.barke2,
Dco.mobili.
