Background
Two known enzymes catabolize the essential amino acid
tryptophan in mammals. Tryptophan 2, 3 dioxygenase (TDO) is
expressed predominantly in hepatic tissues and was the
first inducible enzyme system discovered in mammals [ 1].
It controls serum tryptophan homeostasis and is induced
following ingestion of tryptophan. A second enzyme, IDO, is
distinguished from TDO by its expression pattern, substrate
specificity and inducibility. IDO is expressed in a variety
of non-hepatic tissues, including placenta, lung, gut and
epididymis [ 2, 3, 4]. Except for the last named tissue
where IDO is expressed constitutively, IDO is inducible by
inflammatory mediators, including interferons. In addition,
IDO catalyzes the breakdown of a variety of compounds which
contain an indole ring, including D-tryptophan and
serotonin, marking another difference from TDO, which is
specific for L-tryptophan. Curiously, it appears as if
tryptophan itself cannot induce IDO synthesis [ 5]. IDO is
also suggested to be the evolutionary ancestor of certain
novel myoglobins which occur in molluscs, marking IDO as an
evolutionarily primitive enzyme [ 6].
IDO is known to be expressed in cells infected with
intracellular pathogens such as
Toxoplasma and
Chlamydia species and also by viruses
[ 7, 8, 9, 10]. In the case of
Toxoplasma and
Chlamydia it has been proposed that
IDO induction is a cellular defense mechanism, designed to
limit the proliferation of the invading pathogen by
depleting the essential amino acid tryptophan. IDO
expressed in monocyte derived macrophages has also been
found to inhibit the growth of extracellular bacteria such
as group B streptococci [ 11], and is also induced in
tumors taken from cancer patients [ 12]. In all of these
systems the proximal inducer of IDO activity is
interferon-γ (IFN-γ). Response elements for this cytokine
have been identified in the human IDO promoter and have
been shown to be essential for IFN-γ induction of reporter
gene expression
in vitro [ 13, 14, 15].
The unusual tissue distribution of IDO suggests that
combating infection is not its only function. Our interest
in IDO arose when we observed that tryptophan depletion was
responsible for macrophage-induced inhibition of T cell
proliferation
in vitro [ 16]. Furthermore, we
reported that a pharmacologic inhibitor of IDO, 1-methyl
tryptophan, induced maternal rejection of allogeneic but
not syngeneic murine fetuses [ 17]. As IDO is strongly
expressed at the maternal-fetal interface in pregnant mice
and women, we have suggested that IDO plays a role in fetal
defense against the maternal immune system and could
represent a novel means of immunoregulation. The apparently
diverse functions and tissue distribution of IDO may have
as a common theme the fact that tryptophan is the rarest
essential amino acid and could be the target for cellular
regulatory mechanisms. If so, tryptophan concentrations in
cellular microenvironments might play a critical role in
modulating various cellular processes in a way that cannot
be achieved by the hepatic enzyme TDO which regulates
systemic tryptophan concentrations.
The IDO promoter contains a diverse collection of motifs
together with the IFN-γ response elements. These include
motifs for transcription factors that bind to collagenase
and elastase genes and motifs for the transcription factor
MEP-1, which regulates transcription from the
stromelysin-1 (MMP-3) and
metallothionein genes [ 18, 19].
Matrix metalloproteinases (MMPs) are responsible for
modification of the extracellular matrix and are involved
in wound healing, tumorigenesis, pregnancy and
inflammation. In general, they regulate how cells interact
with each other and with the extra-cellular matrix.
Evidence for a tryptophan-reversible inhibition of MMP
expression by IFN-γ has previously been presented [ 20,
21], although the exact mechanism is unclear. Therefore we
decided to directly test whether IDO plays a role in
controlling interactions with other cells and also the
surrounding extracellular environment.
We have identified cells expressing IDO
in vitro and used IDO antisense
constructs to inhibit this expression. In addition, we have
constitutively overexpressed IDO in adherent and
non-adherent cell lines
in vitro. Our results demonstrate
that tryptophan catabolism has significant effects on cell
adhesion and regulates the activity and expression of
cyclooxygenases 1 and 2 (COX-1 and -2).
Results
Constitutive overexpression of IDO alters cell
adhesion
To determine whether IDO plays a role in regulating
cell adhesion, we expressed a full-length IDO cDNA in
cell lines
in vitro . We transfected the
murine macrophage cell line RAW 264.7 with a construct in
which IDO was expressed under the control of the murine
MHC Class II promoter (Fig 1A). IDO-transfected RAW cell
clones, which expressed IDO under the control of the MHC
Class II promoter, were characterized for IDO expression.
We selected four clones with varying capacities for IDO
expression and tryptophan depletion from culture medium
(Fig 1B,C,D,E). Following 48 hours in culture, clones 22
and 11 depleted tryptophan to a greater extent than
clones 6 and 8 or vector only control, consistent with
the greater vector copy number of these clones. However,
none of the clones depleted a substantial proportion of
the tryptophan present in medium even with longer
incubation times. A common feature of the tryptophan
depleting clones was their tendency to form macroscopic
foci, which were visible to the naked eye (Fig 2,A,B,C).
At a certain point in focus growth, multicellular
aggregates of RAW cells would break off from the focus
and could be seen floating in suspension in the tissue
culture medium. Wild type RAW cells or RAW cells
transfected with vector alone and, to a lesser extent,
clones 6 and 8 demonstrated a reduced ability to form
macroscopic foci.
To determine if this phenomenon was unique to RAW
cells, we also transfected the MC57 murine fibrosarcoma
cell line [ 22] which grows as a monolayer. MC 57 cells
are fibroblastic in appearance and disperse across the
surface of a tissue culture dish in a uniform manner.
Transfection of a full length, constitutively expressed
IDO cDNA into MC57 cells in the pcDNA3 expression vector,
resulted in MC57 cells developing a more rounded
phenotype. Furthermore, cells grew as multicellular foci,
in a confined area, similar to RAW cells, although the
foci did not grow to as large a size before detaching
from the plate (Fig 2D,E). The murine monocytic cell line
P388 was also transfected and expressed IDO. It likewise
exhibited a change in morphology similar to that
described above and clones expressing IDO often changed
from non-attached suspension cultures to adherent
cultures which resembled RAW cells(not shown).
IDO-expressing clones were also slower to re-attach to
tissue culture dishes following sub-culture and could be
seen floating as multicellular aggregates. To quantitate
the change in cell adhesion in IDO-transfected RAW cells,
we performed binding studies to tissue culture plates
coated with various extra-cellular matrices, including
collagen, laminin, matrigel, and fibronectin. Neither
vector-only controls nor IDO-expressing cells adhered
significantly to laminin or matrigel coated plates in a
45 minute assay period (not shown) and both controls and
IDO-expressing cells adhered strongly and to similar
extents to fibronectin coated plates (Fig 3A). However,
there was a substantial difference in adhesion to
collagen-coated plates. Although neither sample adhered
to collagen to the same extent as to fibronectin, vector
only controls adhered more strongly than IDO-expressing
clone 11 (Fig 3B).
IDO expression is induced during cell attachment to
growth substrates
To determine if IDO normally plays a role during the
course of cell adhesion, we detached log phase, wild type
RAW cells from their culture flasks by scraping, reseeded
them into fresh medium and assayed for IDO expression at
subsequent time points. Log phase cells do not express
IDO at levels detectable by standard RT-PCR methods.
However, in cells detached from their normal growth
substrate, IDO expression was already induced by 5 hours
following reseeding into fresh tissue culture dishes and
expression was detected until 48 hours (Fig 4A). Onset of
expression coincided with the time when the majority of
cells had begun to adhere to the plate.
To determine if IDO expression was restricted to cell
interactions with standard tissue culture substrates and
to further explore the possibility that IDO altered
inter-cellular adhesiveness, we studied the murine
embryonic carcinoma cell line P19. This cell has been
characterized extensively and differentiates into
skeletal and cardiac muscle or neuronal cells, depending
on whether it is treated with DMSO or retinoic acid (RA)
respectively [ 23, 24, 25]. Differentiation is dependent
on an initial, 3-5 day incubation as multicellular
aggregates in suspension culture, in the presence of
drug, followed by a similar period growing as monolayer
adherent cells in the absence of drug. Mature
differentiated cells begin to appear during this
subsequent growth period in the absence of drug.
IDO expression was detected when P19 cells were
reseeded into bacterial petri dishes as suspension
cultures and allowed to form aggregates. IDO expression
was observed within 12 hours of seeding into suspension
with DMSO and peaked around 48-54 hours. (Fig 4B). Thus,
removing cells from their normal growth substrate and
reseeding into fresh medium induced a burst of IDO
expression irrespective of whether cells reassociated
with tissue culture substrate or other cells. Aggregating
cells in the presence of 10 -6M RA, which induces
neuronal differentiation also induced a transient burst
of IDO transcription but the period was shorter and the
peak level observed was lower than that observed with
DMSO.
To determine if IDO expression was related to the
removal of cells from their normal growth substrate or
the process of reattachment to new substrate, we
trypsinized P19 cells and reseeded them as aggregates in
suspension in the presence of various concentrations of
EGTA. EGTA chelates essential Ca 2+required by cadherin
molecules and inhibits cell adhesion. We observed a
concentration dependent decrease in IDO expression in
EGTA treated samples 24 hours after seeding, which
paralleled a corresponding decrease in cell aggregation
(Fig 4C). Therefore, IDO expression appeared to be
induced by reattachment, rather than detachment from a
previous substrate. Thus, IDO is thus expressed
endogenously in various cell types and is induced during
cell attachment to growth substrates.
Inhibition of endogenous IDO expression disrupts
P19 cell adhesion
To examine the role of IDO expression in P19 cells, we
transfected P19 cells with a DNA construct which
contained a 740 bp fragment of murine IDO cDNA in the
antisense orientation, under the control of the
constitutively active CMV promoter in the pcDNA-3
mammalian expression vector. As control, the IDO gene
fragment was cloned in a sense orientation. To confirm
that transfected, G418 resistant P19 cells expressed IDO
antisense transcripts, we isolated total RNA from G418
resistant clones, reverse transcribed it into cDNA using
a sense primer then PCR amplified the cDNA. Three
antisense-transfected clones, which expressed
progressively greater amounts of IDO antisense RNA were
selected for further analysis together with a sense
control (Fig 4D). The ability of the sense and antisense
transfectants to deplete tryptophan from culture medium
was determined following 48 hours in culture. IDO sense
transfected P19 cells depleted 10% of available culture
tryptophan (not shown) while IDO antisense transfected
P19 clones which expressed high levels of antisense
(clones D3 and E6) depleted essentially no tryptophan
from the medium. Clone C2, which expressed low levels of
IDO antisense, depleted similar levels of tryptophan to
the sense control. Therefore, the burst of IDO
expression, which takes place in cells during
reattachment does not result in substantial tryptophan
depletion from culture medium
IDO antisense-transfected clones D3 and E6 exhibited a
different phenotype compared to untransfected and sense
transfected P19 cells (Fig 5A,B,C). IDO antisense
expressing clones developed a rounded appearance with a
more scattered morphology and apparent loss of cell
interaction instead of the usual, adherent P19 phenotype.
The degree to which this phenotype manifested, correlated
with the extent of IDO antisense expression, i.e. it was
prominent in clone E6 and D3 while clone C2 was
indistinguishable from sense-transfected controls.
However growth rates were largely unaltered.
IDO-antisense and sense transfectants were aggregated in
1% DMSO and cell aggregates were visualized by phase
contrast microscopy. Sense or untransfected P19 cells
aggregated normally as tightly packed spheroid bodies. In
contrast, antisense transfectants formed aggregates,
which exhibited markedly different morphologies and
differed from sense-transfected aggregates in two
principal respects; shape and size (Fig 5D,E,F). At 30
hours after seeding suspension cultures, cells formed
irregular shaped, non-spherical aggregates that were less
tightly packed than control aggregates. Antisense clone
E6 (shown in Fig. 5F) produced aggregates which were only
loosely packed and a substantial number of cells which
did not package into any form of aggregate while
antisense clone D3 formed aggregates more diverse in
shape than the uniformly spherical controls but less
diverse than clone E6. Clone C2 produced aggregates
similar to sense transfected controls (not shown).
To quantitate and compare the size difference between
sense and antisense-transfected aggregates we
photographed sense and antisense clone 5 aggregates and
calculated the area of each aggregate individually (Fig.
5G). Antisense aggregates were small, predominantly in
the 0.2-0.4 sq. inch size range, whereas control
aggregate sizes were spread over a much broader range.
The mean size of antisense-transfected aggregates was
0.31 sq. inches, while sense transfected controls had a
mean of 0.69 sq. inches (p < 0.0001). The effect of
IDO inhibition on cell adhesion was demonstrated by
performing cell migration assays. P19 cells were seeded
into porous tissue culture inserts placed in a 24 well
tissue culture plate and cell migration to the lower
chamber in the absence of any stimulus was determined.
Approximately 12% of clone E6 cells migrated to the lower
chamber 18 hours after seeding into the upper chamber
(Fig. 5H). In contrast, less than1% of control cells had
migrated in the same period. Clones C2 and D3 produced
intermediate levels of migration. When inserts were
coated with Matrigel, no significant migration was seen
in either antisense or sense transfectants, indicating
that cell motility could be inhibited by supplying an
extracellular matrix.
IDO axpression alters metalloproteinase
expression
The altered adhesion of IDO-expressing RAW cells to
collagen suggested that IDO might induce alterations in
enzymes involved in modifying the extracellular matrix.
Therefore, we investigated whether inhibition of IDO
expression in the P19
in vitro aggregation system and the
constitutive overexpression of IDO in RAW cells had any
effect on MMP expression. We allowed the sense and
three-antisense expressing clones of P19 to aggregate in
1%. DMSO for 24 hours, before harvesting total RNA and
determining expression of various MMP genes, including
stromelysins 1 (MMP-3),
2 (MMP-10) and
3 (MMP-11),
collagenases I (MMP-1) and
IV (MMP-2) and
meltrins α (ADAM-12) and β
(ADAM-19).
Meltrin α is expressed
in vivo during development in
condensed mesenchymal cells that give rise to skeletal
muscle while meltrin β is expressed in craniofacial and
dorsal root ganglia where neuronal lineages differentiate
[ 26]. Expression of
stromelysin s-
1 and
3 and
meltrin α , was increased in
antisense-expressing aggregates, relative to the sense
control (Fig 6A). Furthermore, there was a progressive
increase in the expression level of these three protease
genes, which correlated with the amount of IDO antisense
expression. In contrast, the expression of
meltri n-β and
stromelysi n-
2 was similar in all samples and
expression of
collagenase I or
IV was undetectable in either sense
or antisense-expressing aggregates (not shown). Thus,
inhibition of IDO gene expression correlated with
increased expression of some but not all MMP genes in P19
cells undergoing aggregation. Furthermore, increased MMP
expression coincided with decreased ability of P19 cells
to aggregate in suspension culture. To determine whether
IDO-expressing RAW cells also showed unusual MMP
expression we tested the IDO-expressing RAW cell clones
for the same group of MMPs as P19 cells. Expression of
all MMPs was undetectable except for collagenase I. This
showed significant expression in vector-only controls but
little or no expression in IDO-expressing clones. All
IDO-expressing clones demonstrated reduced expression
with no correlation to the level of IDO expression (Fig
6B). Pharmacological inhibition of MMP activity in P19
cells using the broad spectrum, hydroxamic acid-based MMP
inhibitor GM 6001 at concentrations ranging from 1-30 μM,
resulted in partial reversal of the poor aggregation
shown by IDO-AS expressing cells, with a maximal effect
shown at 20 μM, indicating that changes in MMP expression
were responsible, at least in part for altered cell
adhesion.
IDO regulates prostaglandin synthesis
To understand the mechanism of IDO induced alterations
in cell adhesion and MMP expression, we attempted to
reverse IDO effects on cell adhesion. As previously
mentioned, tryptophan is not significantly depleted in
culture medium of RAW cells overexpressing IDO,
suggesting that tryptophan deprivation is not the cause
of the IDO effect. Consistent with this, adding back
tryptophan to IDO-expressing RAW cells did not reverse
the growth of macroscopic foci. As tryptophan is not the
only substrate for IDO, we also investigated whether
adding serotonin would overcome the effects of IDO
expression. There was a similar lack of effect of this
compound. This suggested that depletion or reduction of
an IDO substrate was probably not responsible for the
effects described here. An alternative possibility was
that a biologically active downstream catabolite of IDO
could be the cause. Therefore, we tested the tryptophan
catabolites, picolinic acid and quinolinic acid to see if
they could reproduce the effects of IDO overexpression.
Picolinic acid (1-6 mM) produced morphological changes in
both MC57 and RAW cells and also substantial reductions
in growth rate but did not mimic the effects of IDO
expression. In particular, at a concentration of 2 mM,
picolinic acid induced a more flattened phenotype. At
concentrations above 6 mM, picolinic acid-induced
apoptosis was observed. Quinolinic acid was essentially
without effect at concentrations up to 10 mM. Therefore,
the exact mode of action of IDO therefore remains to be
determined.
Despite the uncertainty about the proximal mediator of
IDO's effect, it is known that alterations in cell
adhesion and metalloproteinase activity are often
associated with changes in prostaglandin synthesis [ 27,
28, 29, 30]. Therefore, we analyzed the spectrum of PGs
produced by IDO-expressing RAW cells using thin layer
chromatography. PG D
2 was the major product of both
vector-only controls and IDO-expressing clone 11,
consistent with reports that D
2 production is typical of
antigen-presenting cells [ 31]. There was a greater than
50% reduction in PG D
2 production in clone 11 compared with
the vector only control and a similar decrease in levels
of PGs F
2α , 6keto-F
1α and thromboxane B
2 in this clone (Fig 7A). However, PG
E
2 production was affected relatively
little compared to the other PGs. Thus IDO overexpression
resulted in an increase in PG E
2 relative to the other PGs. However,
in MC57 cells, the prostaglandin profile was quite
different from that seen in RAW cells. PG E
2 was the dominant prostaglandin (Fig
7B) and overexpression of IDO resulted in a relative
increase in the amount of PG D
2 and other PGs, relative to E
2 .
In IDO-expressing RAW cells, COX-1 protein levels were
unchanged compared to the vector-only control (Fig 8A).
In contrast, COX-2 was not expressed by vector only
controls or RAW clones 6, 8 and 22 but COX-2 mRNA and
protein was induced in the RAW clone expressing the
greatest amount of IDO (clone 11) (Fig 8A). Although
COX-2 is not usually expressed in RAW cells, it can be
strongly induced with lipopolysaccharide (LPS) [ 32, 33].
Therefore, we treated IDO transfected RAW cells and
controls with LPS and measured COX-2 expression 24 hours
later. COX-2 mRNA was most strongly induced in vector
only or low IDO-expressing clones (Fig 8B). Curiously,
clones expressing higher levels of IDO (clones 22 and 11)
showed lower levels of COX-2 mRNA induction. In contrast,
COX-2 protein levels were higher in clones expressing
lower amounts of IDO mRNA and lower in vector only
controls, whereas COX-1 protein levels were unchanged by
LPS treatment. MC57 cells expressed COX-2 constitutively,
consistent with the domination of the PG profile by PG E
2 . However, IDO overexpressing clone
26 showed a reduced amount of COX-2 protein compared to
the vector only control (Fig 8C).
If uniformly diminished PG synthesis by IDO was
responsible for growth of RAW cell macroscopic foci,
inhibiting PG synthesis with a pharmacological inhibitor
of COX-1 and -2 ought to reproduce the effect of IDO
expression. Therefore we treated vector-only transfected
RAW cells with various concentrations of indomethacin
ranging from 0.1 μM to 100 mM. Although some effect of
indomethacin on cell growth rate was observed, there was
no sign of macroscopic foci (data not shown). Thus IDO
expression does not mimic the effects of a global COX
inhibitor. To test the hypothesis that alterations in the
relative levels of PGs were responsible for the growth of
macroscopic foci, we added PGs directly to vector-only
transfected RAW cells. The phenotype produced by IDO
expression could be reproduced by adding PG E
2 alone to the cultures. PG E
2 addition resulted in a
dose-dependent increase in the appearance of macroscopic
foci, with visible foci appearing at 1 ng/ml (3 nM) and
becoming abundant at 10 ng/ml (30 nM) (Fig. 9A). Adding
PG F
2α at the same time as E
2 resulted in a reduction of the
number of foci. Surprisingly, addition of PG D
2 also resulted in a slight increase
in focus numbers (not shown).
We next attempted to reverse the phenotype seen in
clone 11 cells. If increased PG E
2 production relative to other PGs was
responsible for the appearance of macroscopic foci, then
adding back increasing amounts of other PGs such as D
2 and F
2α should restore the phenotype of
clone 11 to that of vector only controls. As PG F
2α attenuated the focus forming
ability of PG E
2 in the experiment shown in Fig. 9A,
we added PG F
2α in various concentrations to clone
11 cells. PG F
2α at 10 ng/ml (30 nM) substantially
reduced the focus forming ability of IDO expressing clone
11 (Fig 9B). Thus an alteration in the PG E
2 /F
2α ratio plays an important role in
mediating IDO's effects on cell growth and
morphology.
Discussion
Tryptophan catabolism by cells expressing IDO is
something of an enigma and has resulted in speculation as
to why the body requires two enzymes with different tissue
specificities to degrade the rarest essential amino acid [
5, 34]. The inability of IDO to be induced by its own
substrate exemplifies this puzzle. While IDO's role in
controlling intracellular pathogens is well documented,
there is little understanding of the reasons for IDO
expression at sites in the body unlikely to be related to
this function, such as the epididymis. The data we present
here reveal that IDO expression is an important determinant
of the way in which cells interact with their extracellular
environment
in vitro . In particular, cell
adhesion is altered dramatically by overexpressing IDO in
cells which do not otherwise express it, or inhibiting IDO
expression in cells in which it is naturally induced
following cell passage. Specifically, overexpression of IDO
in RAW and MC57 cells resulted in the growth of macroscopic
foci and other phenotypic alterations. The cell foci were
multicellular aggregates, which grew vertically as well as
horizontally across the plate surface and contained
significant numbers of necrotic cells within their
interior, as judged by trypan blue exclusion. Conversely,
in P19 cell aggregates in which IDO expression was
inhibited, there was a more dispersed phenotype with cells
losing the ability to interact with each other. We have
recently confirmed that IDO expression in RAW cells
following cell passage is likewise important for correct
cell adhesion (results not shown).
Our data support the hypothesis that IDO-induced
alterations in PG synthesis can modify cell adhesion. We
observed changes in the relative amounts of PGs in
IDO-transfected RAW cells and reversal of the effects of
IDO-expression by PG F
2α while PG E
2 stimulated focus formation. COX-2 was
upregulated in IDO-expressing RAW cells. Similar effects of
PG E
2 on cell morphology have recently been
reported in the human embryonic kidney cell line HEK 293,
which overexpressed COX-2 and PG E
2 synthase [ 35]. COX-2/PG E
2 synthase-expressing cells were highly
aggregated, piled up and exhibited round shape morphology
similar to the RAW cells described here. MC57 cells, which
demonstrated similar changes in cell adhesion to RAW cells
following IDO expression, exhibited lower levels of COX-2
synthesis upon IDO expression and lower levels of PG E
2 relative to other PGs such as D
2 . Furthermore, adding back PGE
2 to IDO-expressing MC57 cells did not
reproduce the wild type phenotype (not shown). Thus,
similar effects on cell morphology were produced by
opposite effects on COX-2 expression and PG E
2 production in these two cell lines. We
are presently attempting to determine if products of COX-2
activity other than E
2 may be responsible for IDO effects in
this cell line.
The mechanism of PG-induced changes in cell adhesion and
morphology may involve MMP activity. Synthesis of MMPs such
as collagenase I (MMP-1), gelatinase B (MMP-9) and
matrilysin (MMP-7) has been shown to be dependent on the
synthesis of PG E
2 , suggesting that alterations in MMP
expression may be instigated by alterations in PG synthesis
[ 27, 28, 29, 30]. Furthermore, both COX-1 and COX-2 have
recently been shown to mediate adhesion of various cell
types
in vivo and
in vitro [ 36, 37]. Thus, one
possibility is that alterations in MMP expression and
activity could modify cellular interactions with the
extracellular matrix following IDO expression. Consistent
with this possibility is the observation that MMP
expression in P19 cells was correlated with the degree of
IDO-antisense expression. RAW transfectants over-expressing
IDO showed reduced expression of collagenase I (MMP-1), and
also bound less well to collagen-coated plates than
controls. Collagen is one of the principal components of
the extracellular matrix and RAW cells bind poorly to
fibrillar type I collagen unless it is denatured or
activated by collagenase [ 38]. Thus, the diminished
expression of MMP-1 in IDO transfectants could explain
their weaker binding to this substrate. The mechanism by
which IDO regulates prostaglandin synthesis is yet to be
determined. Tryptophan is a stimulatory co-factor for COX
and degradation of tryptophan in the intracellular
environment could alter COX activity. Alternatively, IDO
might influence COX activity and expression through
competition for or release of heme, which both enzymes
require.
In vitro , arachidonic acid
stimulates the dissociation of heme from IDO and this
correlates with IDO stimulatory effects on COX [ 39],
providing circumstantial support for the latter
possibility.
The alterations in COX-2 expression observed in
IDO-expressing RAW and MC57 cells are a particularly
interesting feature of our results. COX-2 is inducible by a
number of inflammatory mediators including IFN-γ [ 40] and
LPS [ 32]. These also induce IDO. Treatment of
IDO-expressing RAW clones with a known inducer of COX-2
(LPS), revealed a lack of correlation between COX-2 RNA and
protein levels. Clones 11 and 22 showed low levels of COX-2
message but high levels of protein following LPS treatment.
This suggests that COX-2 RNA and/or protein turnover may be
affected by IDO expression. Other workers have noted that
non-steroidal anti-inflammatory drugs, which inhibit COX
activity result in increased COX protein expression [ 41],
while differences between COX protein expression and
activity have been reported to be produced by some
cytokines, including tumor necrosis factor-α, and also
nitric oxide donors [ 42, 43]. Although not well
understood, evidence for regulation of COX expression at
the post-transcriptional level is increasing [ 44, 45]. The
down regulation of COX-2 transcripts in LPS-treated,
IDO-expressing RAW cells is reminiscent of the endotoxin
tolerance effect observed in human THP-1 promonocytic
cells. Cells pretreated with LPS and thus expressing COX-2
showed down regulation of COX-2 mRNA when subjected to a
second LPS exposure [ 46]. In addition, the COX-2 inhibitor
flufenamic acid induced COX-2 expression in RAW cells but
inhibited TNF-α or LPS-induced COX-2 expression in the same
cell type [ 47].
As both MMPs and COX-2 are important factors in tumor
development [ 48, 49] IDO's role in tumorigenesis bears
investigating. We have observed IDO expression routinely in
murine tumors
in vivo , and are presently
investigating the growth properties of tumors with altered
IDO expression. In addition, our recent work indicates a
role for IDO during pregnancy. Pharmacological inhibition
of IDO results in pronounced inflammation, complement
activation and fetal loss [ 17, 50]. Prostaglandins may
provide a common link between these important biological
phenomena.
Conclusions
IDO regulates adhesion of cells to normal growth
substrates. In so doing it modulates the expression and
activity of COX-2 and certain MMPs. RAW cells and MC57
cells overexpressing IDO grew as multicellular foci. In the
case of RAW cells, this was due to elevated PGE relative to
other prostaglandins. P19 cells in which endogenousIDO
expression was disrupted by antisense expression, showed
lower adhesiveness. Thus, tryptophan catabolism exerts
control over fundamental cellular functions.
Materials and Methods
Cells
P19 cells were obtained from the American Type Culture
Collection and cultured as described [ 23]. Cells were
differentiated into myocytes or neurones using 1% DMSO
and 10 -6M RA respectively as previously reported [ 23,
24]. RAW 264.7 cells were a gift of Dr. D. Greaves
(Oxford, England) and were cultured in Iscove's Modified
Dulbecco's Medium supplemented with 10% fetal calf serum.
MC57 cells were obtained from Dr. Dimitrios Moskiphidis,
Medical College of Georgia and grown in Iscove's Modified
Dulbecco's Medium.
IDO expression
A full length, 1.2 kb IDO cDNA was amplified from
IFN-γ stimulated RAW cells and cloned into pGEM T-Easy
(Promega), using primers; 5' TAG CGG CCG CGT AGA CAG CAA
TGG CAC TC 3' forward, 5' TAA GAT CTT ACA CTA AGG CCA ACT
CAG 3' reverse, which contain Not I and Bgl II sites
respectively. The 1.2 kb IDO PCR fragment was excised
with Not I and Bgl II and cloned into the Not I-Bgl II
site in the pDOI vector [ 51], previously modified by the
introduction of a Not I site in front of the Eco RI
cloning site. Plasmid DNA was linearized and transfected
into RAW cells by electroporation. Stably transfected
lines were selected in 400 mg/ml G418 and thereafter
maintained in 200 mg/ml G418. MC57 cells were also
transfected by electroporation and selected in 1.2 mg/ml
G418.
RT-PCR
Analysis of gene expression in P19 or RAW cells was
performed using semi-quantitative RT-PCR. Total RNA was
isolated from cells using RNA STAT-60 (Tel-Test Inc.) and
1 mg was amplified for 25 cycles unless otherwise stated,
following reverse transcription in a one step reaction
(RT-PCR "Access", Promega). 5 μl of the 50 ml reaction
volume was electrophoresed on 0.8% agarose gels prior to
Southern blotting and hybridization with a specific
probe. Primers and amplification conditions for IDO
amplification have been described elsewhere [ 17].
Primers for amplification of other gene specific
transcripts were as follows; stromelysin-1; 5'
GATGACAGGGAAGCTGGA forward, 5' ACTGCGAAGATCCACTGA
reverse. Stromelysin-2; 5' GATGTACCCAGTCTACAGGT 3'
forward, 5' TGTCTTGTCTCATCATTACT 3' reverse.
Stromelysin-3; 5' CTGCTGCTCCTGTTGCTGCT 3' forward, 5'
ACCTTGGAAGAACCAAATC 3' reverse. Meltrin-α; 5'
TGCATCAGTGGTCAGCCTCA 3' forward, 5' CTTTCTCTGCGGCCATTCTG
3' reverse. Meltrin-β; 5' TTCAGTTTACACATCAGAC 3' forward,
5' AGGTCACATTGCCGAACCT 3' reverse. Collagenase I; 5'
GATTGTGAACTATACTCCT 3' forward, 5' CCATAGTCTGGTTAACATCA
3' reverse. Collagenase IV; 5' GTATGGAGCGACGTCACT 3'
forward, 5' CGCTCCAGAGTGCTGGCA 3' reverse. GAPDH; 5'
TGCAGTGGCAAAGTGGAG 3' forward 5' CCATCCACAGTCTTCTG 3'
reverse.
Antisense inhibition of IDO expression
Constructs which expressed either sense or antisense
IDO RNA were produced by cloning a 740 bp RT-PCR fragment
of the IDO gene, described in [ 17], into the T-tailed
cloning vector pGEM T-Easy (Promega). This fragment was
excised with Not I and subcloned into the Not I site of
the mammalian expression vector pcDNA3 (Invitrogen), in
either the sense or antisense orientation. Following
linearization with Bgl II, the constructs were
transfected into the P19 cell line using Lipofectamine
(Gibco-BRL) at a concentration of 25 μl per 100 ml of
serum free medium. Stable transfectants were selected in
400 mg/ml G418 over a period of 4 weeks and subsequently
maintained in the absence of G418 in normal growth
medium. Periodic checks of G418 resistance revealed no
significant loss of the resistance phenotype.
Confirmation that resisitant clones expressed IDO
antisense RNA was obtained by isolating total RNA from
G418 resistant clones, treating with ribonuclease free
DNase RQ1 (Promega) and reverse transcribing RNA into
cDNA in the presence of an IDO sense primer [ 17]. An
antisense primer was then added and the cDNA PCR
amplified for 25 cycles. Products were electrophoresed in
0.8% agarose.
Western blotting
RAW cells expressing IDO and vector only controls were
harvested in cell lysis buffer (PBS, 1%NP40, 0.5% sodium
deoxycholate, 0.1% SDS, 150 ng/ml PMSF, 100 ng/ml
aprotinin) and 25 μg of cell protein was electrophoresed
on 10% polyacrylamide gels overlayed with a 5% stacking
gel. Protein was quantitated using the BCA assay
(Pierce). COX-1 and COX-2 antibodies (Santa Cruz
Biotechnology Inc) were used in combination with standard
ECL techniques. Rabbit polyclonal IDO-specific antibody
was generated against a C-terminal peptide of 42 amino
acids; KPSKKKPTDGDKSEEPSNVESRGTGGTNPMTELRSVKDTTEK.
Measurement of tryptophan depletion by HPLC
Supernatants from cell cultures were extracted with
HPLC grade methanol and analyzed on a Beckman Phenomenix
C18(2) HPLC column and eluted with a 0-80% gradient of
acetonitrile over 20 minutes. To validate retention times
and for the construction of a concentration curve a
standard mixture of kynurenine and tryptophan was
analyzed for each assay.
Analysis of prostaglandin production
Prostaglandin synthesis was measured by pulsing
IDO-expressing RAW cells and vector only controls with
14C arachidonic acid (Sigma). 5 × 10 6cells were
harvested and resuspended in PBS and incubated at 37°C
with 1.3 mCi arachidonic acid (53 mCi/mmol) for 30 mins.
Following ether extraction, samples were dissolved in
ethyl acetate and spotted onto thin layer chromatography
plates. Plates were developed in ethyl acetate: acetic
acid, 90:1, together with unlabeled standards. Individual
spots were excised from the chromatogram and
radioactivity determined by scintillation counting.
Cell adhesion assay
Cell adhesion assays were performed essentially as
described [ 36]. Briefly, cells were seeded into the
wells of a 24 well plate coated with various growth
substrates Following incubation at 37°C, for 45 minutes,
cells unattached cells were removed by PBS washes and the
remaining cells were counted.
Cell migration assay
P19 cells in log phase growth were trypsinized and 10
5were seeded in quadruplicate into Falcon cell culture
inserts, with or without Matrigel coating (Becton
Dickinson, Franklin Lakes, NJ, 8.0 μm pore size, 1 × 10
5pores/sq.cm), in a volume of 0.2 ml, in a 24 well tissue
culture plate. The lower chamber contained a volume of
0.8 ml growth medium, while the final volume in the upper
chamber was 0.35 ml. Chambers were incubated for 18 hours
after which time the number of cells in the lower chamber
was determined.
Image analysis
The size of individual P19 aggregates was determined
by capturing fields of 40-50 aggregates at 10x
magnification and then calculating the area of each
aggregate using the NIH Image (1.62) analysis program (
http://rsb.info.nih.gov/nih-image/download.html).
Abbreviations
CMV: cytomegalovirus
COX: cyclooxygenase
IDO: indoleamine 2,3 dioxygenase
IFN-γ interferon gamma
LPS: lipopolysaccharide
MMP: matrix metalloproteinase
NSAID: non-steroidal anti-inflammatory drug
PG: prostaglandin
TDO: tryptophan 2, 3 dioxygenase
