Background
Proteins recognizing specific DNA sequences play an
important role in the regulation of gene expression and in
DNA replication. Nearly all eukaryotic genes transcribed by
RNA Polymerase II for instance, contain the conserved TATA
box which is present upstream of the transcription start
site. The TATA-box binding protein, a ~30 kDa component of
the TFIID complex binds specifically to the heptanucleotide
A and T residues [ 1 ] and forms the core of the
transcription initiation complex. Additionally, many
specific transcription factors bind to the upstream
promoter in a sequence specific manner and regulate gene
expression. For example in
Drosophila , a heat-shock
transcription factor (HSTF) can bind to consensus
heat-shock response elements [ 2 ] and regulates expression
of heat/stress inducible genes. Promoter activity in later
branching eukaryotes is greatly modulated by enhancer and
repressor sequences which have no activity of their own but
are the targets of DNA biding proteins or protein complexes
which can remodel the promoter chromatin to make it more or
less accessible to RNA polymerase. Biochemical assays have
shown that the action of ATP-dependent chromatin
remodelling activities increase the accessibility of DNA
within chromatin templates.
S. cerevisiae SWI/SNF [ 3 ] , Ino80
complex [ 4 ] ,
Drosophila NURF [ 5 ] are examples of
some high molecular weight chromatin remodelling factors
which can facilitate transcription by binding to
chromatinized DNA templates. However, none of the above
chromatin remodelling factors binds to specific DNA
sequences.
Unlike transcription, the role of sequence specific DNA
binding proteins in eukaryotic DNA replication is not well
characterized. In higher eukaryotes finding of specific DNA
sequences essential for DNA replication has been elusive so
far. In yeast
Saccharomyces cerevisiae , a
six-protein origin recognition complex binds to ARS
consensus sequence (ACS) in a sequence specific manner [ 6
] . Individual ORC subunits have not been demonstrated to
show DNA binding activity
in vitro . Recently, in an
in vitro study ScCdc6 has been shown
to bind double stranded DNA [ 7 ] . The minimal requirement
for the binding of Cdc6 to DNA has been mapped within its
N-terminal 47-amino acid sequence.
Saccharomyces pombe ORC4 subunit has
been reported to contain DNA binding activity by using its
N-terminal AT hook region [ 8 ] . Neither ScCdc6 nor SpORC4
showed any sequence specific DNA binding activity.
Recombinant six protein
Drosophila ORC (DmORC) binds to ACE
region of the
Drosophila chorion gene [ 9 ] .
In vivo , DmORC co-localized with the
amplified chorion gene locus. In Xenopus, biochemical
analysis of replication and cell cycle events using egg
extracts has helped to understand the mechanism of
eukaryotic DNA replication [ 10 ] . However, two
dimensional gel electrophoresis analysis of the rDNA locus
showed that replication initiated at all sites tested [ 11
] . All six human homologs of yeast and
Drosophila ORC subunits have been
cloned and characterized [ 12 13 ] . Other replication
proteins like Cdc6, Cdt1, MCMs, Cdc45 that are essential
for initiation of DNA replication have also been reported [
12 ] . Conservation of replication factors among higher
eukaryotes suggests that functionally they may play similar
roles.
In an attempt to identify DNA binding activity of human
Cdc6, it was expressed and purified as a GST-Cdc6 fusion
protein from baculovirus infected Sf9 insect cells.
Partially purified fractions (reduced glutathione eluate)
containing GSTCdc6 or GST showed an ACS binding activity in
an ATP dependent manner. The GSTCdc6 protein fraction
contained both the GSTCdc6 and a 35 KDa
S. frugiperda protein. The DNA
binding activity was confined to a 35 kDa polypeptide. It
was latter found that the p35 has an intrinsic affinity to
GST. This polypeptide bound to yeast ACS like elements in
the presence of ATP. 9/11 matches to ARS consensus sequence
were found to be essential for this DNA binding activity
both by gel shift assay as well as by in vitro foot
printing assay. A DNA fragment containing 9/11 matches from
human c-myc replication origin region also showed p35
binding activity suggesting that this polypeptide has
intrinsic DNA binding activity. The implications of this
DNA binding activity are discussed here.
Results
Partially purified protein fractions containing
GSTCdc6 or GST contain an ACS binding activity
We infected Sf9 insect cells with the baculovirus
expressing GSTCdc6. Cells were harvested 48 hours post
infection and the proteins were extracted according to
the procedures described in materials and methods. The
GSTCdc6 protein was partially purified by pull down on
glutathione beads (Fig. 1A). The partially purified
protein was used in DNA binding assays with a 240 bp DNA
fragment containing all three conserved boxes (A, B1 and
B2) of the ARS consensus sequences (Fig. 7A& 7B). As
a control, we used GST alone, which was purified using
the same strategy used for GSTCdc6 purification. A DNA
protein complex was formed in both the cases as evidenced
by the retarded mobility of the free 32P phosphate
labelled probe (Fig 1B). The specificity of the DNA
binding was examined in a competition reaction by
increasing the amount of unlabeled DNA fragment
containing ACS like elements. It was determined that the
DNA-Protein complex could be competed efficiently by
increasing amount of unlabelled ACS like DNA (20×, 50×,
100× and 200× respectively) (Fig 2). A ~350 bp DNA
fragment from pBlueScript KS +(
Hin fI digested and subsequently
gel purified) of similar base composition did not compete
with the complex formation in the Electrophoretic
Mobility Shift Assay when added at a similar
concentration indicating a degree of specificity in the
DNA-Protein complex formation (Fig. 2).
An unidentified ~35 kDa protein from baculovirus
infected insect cells is responsible for DNA binding
activity
Partially purified fractions containing GSTCdc6 or GST
showed DNA binding activity. To further fractionate the
proteins present in the partially purified GSTCdc6
fraction the glutathione column was washed with 200 mM
and 300 mM sodium chloride prior to GSTCdc6 elution with
reduced glutathione. Western blot analysis using anti GST
antibodies (Fig. 3A) revealed that neither 200 mM nor 300
mM fractions contained GSTCdc6 (Fig. 3A). GSTCdc6 protein
was present only in the proteins eluted by reduced
glutathione. Proteins released by different salt
fractionation were separated on an SDS-PAGE and
visualized by silver stain (Figure 3B). A prominent band
of molecular mass ~35 kDa was visualised both in the 200
mM and 300 mM salt eluate.
To check whether the DNA binding activity was due to
the presence of ~35 kDa band or GSTCdc6 itself, gel shift
assays were performed either using 50 ng ~35 kDa protein
obtained from the salt wash or GSTCdc6 by itself (Fig.
3C). Salt eluate gave a strong band shift which was
identical with the band shift found with GSTCdc6 found in
Fig. 2. GSTCdc6 eluted from the beads following high salt
wash failed to give any band shift suggesting that the
~35 kDa polypeptide was responsible for the DNA binding
activity.
To further test whether the presence of p35 is
absolutely required for DNA binding activity, the 300 mM
salt eluate was dialysed against low salt buffer H/0.15
and then passed through Superose 12 gel filtration
column. Each fraction was checked for DNA binding
activity by gel retardation assay using a 32P labelled
DNA fragment containing ACS elements. DNA binding
activity was found only in high molecular weight fraction
(~670 kDa) (Fig. 4A). Proteins present in the gel
filtration fractions in the high molecular weight range
(fractions 13-17) were separated by SDS-PAGE followed by
silver stain. Surprisingly, p35 was found to be present
only in the fraction 15 which contains the DNA binding
activity (Fig. 4B). The presence of p35 in the same
fraction containing the DNA binding activity strongly
suggests that p35 is responsible for the binding
activity.
DNA binding activity is ATP dependent
One of the hallmarks of yeast ORC binding to yeast ARS
consensus sequences is its ATP dependence [ 6 ] . We were
interested to see whether the DNA binding activity of the
~35 kDa protein is ATP dependent or not. Gel shift assays
were performed either in the absence or in the presence
of increasing amount of ATP in the reaction mixture (Fig.
5). In the absence of ATP, a very weak binding was
observed whereas with increasing amount of ATP strong
binding was detected. There is a threshold of ATP
concentration (6 mM and onwards) which stimulated the
binding remarkably. A nonhydrolysable ATP analog, ATPγS
was used in the binding reaction to see whether ATP
hydrolysis is required for this binding. With increasing
amount of ATPγS, the band shift was completely inhibited
suggesting that ATP hydrolysis is required for this DNA
binding activity. This was confirmed by adding ATP back
in the reaction mixture when ATPγS was already present in
the reaction. Under these reaction conditions, increasing
amount of ATP again stimulated the DNA binding activity
even in the presence of ATPγS suggesting that ATPγS can
be competed with ATP and it is the ATP hydrolysis which
is essential for this DNA binding activity (Fig. 5, lanes
13 and 14).
p35 binds to A, B1 and B2 boxes of ARS consensus
sequences as revealed by footprinting assay
After establishing the fact that a protein of
approximately 35 kDa binds to DNA fragment containing ARS
consensus sequences, the exact site of binding of the
protein on the DNA was mapped by copper-phenanthroline
footprinting assay. Unlike DNaseI,
1,10-phenanthroline-cuprous complex is a small chemical
probe which can demark the boundaries of the protected
region clearly. The protein was bound to a 5' 32P
labelled 240 bp DNA fragment containing yeast ARS
consensus sequence and separated from the free DNA by gel
shift assay. The gel was then treated with
copper-phenanthroline reagent as described in materials
and methods. The bound and unbound DNA was purified and
allowed to run in a sequencing gel (Fig. 6). On the
T-rich strand (bottom strand) two protected regions were
observed. The first region entirely covered the A box of
the ARS consensus sequence and the second region covered
the overlapping regions of B1 and B2. Therefore the 35
kDa protein has a strong affinity to bind to A, B1 and B2
boxes of the ARS consensus sequences. The long stretch of
protection could be due to multimeric form of p35 or
could be due to the formation of a higher order
nucleoprotein complex.
p35 binds to A, B1 and B2 boxes and mutation in
these boxes abolish DNA binding activity
Previous studies of the structure of ARS1 in both
plasmid and chromosome contexts have shown that it
contains one essential DNA element, A, that includes a
perfect (11/11) match to the ARS consensus sequence (ACS,
Fig. 7A), and three additional elements, B1, B2, and B3,
with 9 out of 11 bases match to the ACS that are also
important for ARS function [ 14 ] . We were interested to
see whether A, B1 and B2 boxes were sufficient to allow
p35 binding activity. We used the p21N protein (N
terminal 150 bases of coding region of p21) [ 15 ] as a
control. This DNA when incubated with ~35 kDa protein
does not form a DNA protein complex (Fig 7D). The DNA
fragment was divided into four subfragments (a, b, c and
d; Fig. 7B) and subcloned in the middle of p21N fragment.
Fragment 'a' does not contain any ACS sequence whereas
fragments b, c and d contain at least one ACS like
element. All the ACS containing sub fragments (b, c, d)
showed a mobility shift (Fig. 7D), which suggests that at
least one ACS like element (either 11/11 match or 9/11
match to ARS consensus sequence) is essential and
sufficient for p35 binding activity. This was further
confirmed by using a subfragment d mutated at the ACS
motif (Fig. 7C). Subfragment d as shown if Fig 7Dlane 10
can bind strongly to the 35 kDa protein, however mutation
altering the A and Ts of the core ACS sequence to G and
Cs (Fig 7C) to generate the dmut oligonucleotide results
in the abolition of its ability to bind p35. Therefore
the ACS sequence is essential for the p35-DNA protein
complex formation.
35 kDa polypeptide binds to ARS consensus sequence
found in c-myc origin of replication
In
S. cerevisiae , ARS elements have
been implicated to be important both for ORC binding and
origin function [ 6 ] . We looked for the availability of
such sequences in known human origins of replication like
c-myc, lamin beta 2 and Dnmt1. An origin of replication
was mapped previously by nascent strand abundance
analysis within 2.0 kb zone immediately upstream of c-myc
gene [ 16 ] . Detailed analysis of the 2.0 kb upstream
sequences revealed the presence of two ACS like elements
separated by 148 nucleotides (AAAAGATAAAG and
AAAAGAAAAAA). A 300 bp DNA fragment containing both the
ACS elements was amplified by polymerase chain reaction
and the product was used subsequently for p35 binding
studies.
A strong band shift was observed (Fig. 8) which could
be competed out using a 50 bp long double stranded oligo
containing two ACS like elements (oligo 'b', Fig. 7B).
Increasing amount of ~65 bp long unrelated (non specific)
double stranded oligo did not have any effect on this
binding activity suggesting that binding of p35 to c-myc
origin region is specific. Interestingly, analysis of
Lamin beta 2 origin of replication region also revealed
the presence of two ACS (9/11 match) like elements [ 17 ]
. Further studies are required to find out whether p35
also binds to lamin beta 2 origin region.
p35-ACS interaction is sensitive to high salt,
temperature and EDTA
The stability of p35-ACS DNA complex was further
tested either by changing NaCl concentration in the
reaction mixture, or by shifting reaction temperature or
by adding EDTA. The DNA binding activity was found to be
sensitive to NaCl concentration (Fig. 9). Strong band
shift was obtained up to 0.2 M NaCl. NaCl concentration
at 0.5 M and above completely inhibited the binding
activity. Higher temperature also showed a drastic effect
on the binding activity. Normal DNA binding activity was
observed up to 42°C. Temperature higher than 42°C
completely abolished the binding activity suggesting that
the off rate of p35 from DNA is much faster at higher
temperature. Finally inclusion of EDTA in the reaction
mixture inhibited the binding reaction suggesting that
the divalent cations are essential for this binding
activity.
Discussion
Few proteins have been reported in the literature, which
are capable of binding to DNA in a sequence specific ATP
dependent manner. Although transcription factors bind to
specific DNA sequences, the binding activity is not
dependent on ATP hydrolysis. In contrast, chromatin
remodelling factors like SWI/SNF, ISW1, BRG1 facilitate
transcription from chromatinised templates in the presence
of ATP [ 18 ] . However, these factors do not bind to
specific DNA sequences. In eukaryotic DNA replication,
sequence specific ATP dependent DNA binding activity has
been demonstrated in yeast
S. cerevisiae where ORC, a six
polypeptide complex binds to yeast ARS consensus sequence
in an ATP dependent manner [ 6 ] . The binding sites for
other ORCs are not very clear at present. DmORC binds the
critical elements of well-characterized, chromosome III
amplification domain (ACE3 and ori-β, though the precise
sequence recognized by DmORC within ACE3 and ori-β have not
been identified [ 9 ] . Studies of both ScORC [ 19 ] and
DmORC [ 20 ] indicate the ATP binding by Orc1p is required
for DNA binding. However ATP hydrolysis is not required for
DNA binding for both the cases suggesting that ATP
hydrolysis may be required for further downstream
processes. Chromatin immunoprecipitation (ChIP) studies
have demonstrated the association of SpORC with
S. pombe origins [ 21 ] and human ORC
with the EBV
Ori P [ 22 23 24 ] . Whether ORC
binds to these sequences directly or indirectly with the
help of other proteins are subject to in vitro DNA binding
assays using purified ORC proteins.
In this study, we report a ~35 kDa protein from the
baculovirus infected Sf9 insect cells that binds to yeast
ACS sequences in an ATP dependent fashion. p35 was purified
as high salt (300 mM NaCl) eluate from the GST-Cdc6 beads.
GST-Cdc6 eluted from the beads following high salt wash
failed to show any DNA binding activity (Fig. 3C) whereas
high salt eluate containing only p35 showed strong DNA
binding activity suggesting that p35 not Cdc6 is
responsible for the binding activity. This experiment was
repeated several times and always the protein preparations
containing p35 showed DNA binding activity.
p35 has an intrinsic affinity to GST moieties. Sf9
insect cells were infected with baculovirus expressing GST
alone. The cell lysate was allowed to bind to GST beads.
High salt eluate (300 mM NaCl) from GST beads was tested
for DNA binding activity. Surprisingly, we observed a very
similar band shift as obtained previously using high salt
eluate from GSTCdc6 (data not shown). Further, high salt
eluate from GSTORC2 and GSTORC4 (GST fusion protein
containing human origin recognition complex subunit 1 and 2
respectively) also showed DNA binding activity (data not
shown). Therefore, it can be concluded that p35 interacts
with GST and high salt concentration is required to disrupt
this interaction. The nature and the specificity of the
interaction between GST and p35 are not clear at this
moment. It is important to note that majority of the p35
bound to GST or GST fusion proteins are released mostly at
high salt concentration (300 mM) allowing us to get rid of
most of the impurities by stringent washing of the GST
beads with buffer containing 250 mM NaCl.
A weak DNA binding activity was found till 4 mM ATP
concentration (Fig. 5). A strong stimulation was obtained
at 6 mM ATP concentration. It is possible that p35 is
purified as ATP bound form but an associated weak ATPase
activity does not allow it to give a strong binding
activity. It is suggested that 6 mM ATP concentration may
be sufficient to overcome this inhibitory effect. ATP
hydrolysis is essential for DNA binding activity of p35
since ATPγ S, a nonhydrolysable analog of ATP completely
inhibited the binding activity (Fig. 5). It is possible
that ATP is required for strand opening which needs to be
further explored. An insect cell factor, polyhedrin
promoter binding protein has been reported previously,
capable of binding to AT rich DNA sequence [ 25 ] .
However, the reported DNA binding activity was unusual in a
sense that the activity was heat and salt concentration
resistant. 100 mM EDTA concentration did not affect the DNA
binding activity. The DNA binding activity reported in this
study was found to be temperature, EDTA and salt
concentration sensitive (Fig. 9) suggesting that this
polypeptide is completely different from the polyhedrin
promoter binding protein.
p35 showed a strong DNA binding affinity towards ACS
like elements. This was confirmed first by using unlabeled
specific competitor DNA which completely abolished the
binding of 32P labelled probe. Competition using unrelated
DNA did not affect the DNA binding activity. We took p21N,
which normally does not bind to p35, to further test the
binding specificity. Introduction of a single ACS like
element (9/11 match) in p21N (ARSc and ARSd) showed a
strong band shift (Fig. 7D) suggesting that only one ACS
like element is sufficient for p35 binding. This was
further confirmed by making mutations in the ARSd fragment.
The resulting ARSdmut did not show any p35 binding activity
suggesting that the ACS like element itself but not the
adjacent sequences are essential for the p35 binding
activity. However, a systematic mutational analysis of ACS
like elements will be required to explore the exact binding
specificity of p35 towards ACS like elements. ACS elements
are normally AT rich. However, p35 did not bind to random
AT rich sequences. p35 did not bind to p21N + ARSa which
contains ARSa oligo (78% AT rich) with no ACS like element.
Surprisingly, p35 showed strong binding activity in the
presence of the oligo ARSb (64% AT rich), ARSc (66% AT
rich) and ARSd (74% AT rich) respectively (Figure 7D).
ARSb, c and d contain at least one ACS like element (Fig.
7B). Finally the copper phenanthroline footprint analysis
confirmed that p35 binds to A and B1-B2 boxes of the ARS1
DNA fragment. At this moment, the function of p35 is not
very clear. It may play major role(s) in the transcription
of certain insect cell genes. It may as well be responsible
for DNA replication. The fact that it binds to yeast ACS
and to a DNA fragment from c-myc origin of replication
region containing yeast ACS like elements in an ATP
dependent manner further strengthen the hypothesis.
S. cerevisiae origin recognition
complex (ORC) binds to ARS consensus sequences in an ATP
dependent fashion and this binding is essential for both
origin function and activity. It is interesting to note
that a huge six protein origin recognition complex binds to
yeast ARS1 whereas p35, a small protein is showing same
kind of protection as evidenced by foot print analysis
(Fig. 6). We believe that p35 forms an oligomeric structure
or it maintains a multimeric form which may explain the
wide footprint over the ARS1 fragment. The presence of p35
in high molecular weight fraction (~670 kDa) following
superose 12 gel filtration chromatography strengthen this
hypothesis and clearly suggests that p35 forms an
oligomeric structure.
ARS consensus sequence has been found near the vicinity
of c-myc, lamin beta 2 and Dnmt1 replication origin [ 26 ]
. Therefore, Identification and characterization of this
protein from insect cells and finding its human counterpart
will greatly help in elucidating its possible function in
DNA replication.
Conclusions
The data presented here leads to the identification and
characterization of a polypeptide from insect cells with
ATP dependent DNA binding activity. This is an important
and unique observation. In
S. cerevisiae , ACS elements have
been reported to be essential for ORC binding and
replication initiation. Yeast ACS like elements found in
c-myc and lamin beta 2 origin region may play similar roles
in replication initiation. However, it is also possible
that p35 is a transcription factor which may facilitate
transcription of some insect cell genes. Further
characterization of p35 from insect cells and finding its
human homolog will be very helpful to dissect its
functional role in replication and/or transcription.
Materials and Methods
Plasmid construction
Cloning of human Cdc6 cDNA is described elsewhere.
Coding sequence of human Cdc6 was cloned in pFastBac-GST
vector (Life Technologies, Inc.) to express GST fusion
protein. A 240 bp DNA fragment from
S. cerevisiae ARS1 chromosomal DNA
replication origin containing all the key elements
including boxes A, B1, B2 and B3 was subcloned in
pBlueScript KS(+) between
Eco RI and
Hin dIII. Subsequently
Eco RI-
Hin dIII fragment was end labelled
using γ 32P ATP and used either for gel shift assay or
copper-phenanthroline foot print assay. p21N, (N terminal
~150 bp of p21) was previously cloned in pBlueScript
KS(+) between
Eco RI and
Hin dIII sites.
Complementary oligos corresponding to ARSa, b, c, d
and dmut (Fig. 7B) were synthesized (~50 bases in length)
and subsequently annealed to get double stranded oligos.
p21N/KS(+) construct contains only one
Stu I site which is present within
the p21N insert. All the annealed double stranded oligos
were cloned into the
Stu I site using blunt end
ligation. The sequences of ARSa, b, c and d are
followed:
ARSa:
ttagtttttcggtttactaaatcgtaatagaaatgtagaacaataaaatgt
ARSb:
tctaaaatacaaatctagaaaatacgaacgaaaagttttccggacgtccgt
ARSc:
cggacgtccgttcacgtgtttgttatgaatttatttatgatgagtcattat
ARSd:
tgagtcattattggataaagaatcgtaaaaactgctttaaacgataaaa
Plasmid containing 2.5 kb DNA fragment from c-myc
origin region was a kind gift from Michael Leffak, Wright
State University Ohio. Forward and reverse PCR primers
(5'-gaagaaaaactctcttttc-3' and 5'-atttgctgggttgaaaaatg-3'
respectively) were used to amplify 300 bp region
containing two ACS like elements.
Expression of GSTCdc6 and GST in insect cells and
purification
Baculoviruses were produced from the recombinant
pFB-GST plasmid using Bac-to-Bac expression system (Life
Technologies Inc.). Sf9 cells (Invitrogen) were infected
with the pFB-GSTCdc6 or pFBGSTbaculovirus according to
the manufacturers' recommendations. Cells were harvested
48 hours post-infection. The cell pellet was washed once
in cold phosphate-buffered saline and subsequently
resuspended in hypotonic lysis buffer (10 mM Tris.Cl, pH
7.9, 10 mM KCl, 1.5 mM MgCl2, 1 mM phenylmethylsulfonyl
fluoride, 2 μg/ml pepstatin, 2 μg/ml leupeptin, 5 μg/ml
aprotinin, 1 mM dithiothreitol). The cell suspension was
homogenized in a Dounce homogenizer using a B-type pestle
followed by centrifugation at 3000 rpm for 7 min. The
pellet containing the nuclei was lysed in buffer H/0.15
(50 mM HEPES/KOH, pH 7.5, 150 mM KCl, 0.02% Nonidet P-40,
5 mM magnesium acetate, 1 mM EDTA, 1 mM EGTA, 10%
glycerol, 1 mM phenylmethylsulfonyl fluoride, 2 μg/ml
pepstatin, 2 μg/ml leupeptin, 5 μg/ml aprotinin, 1 mM
dithiothreitol). The resulting suspension was subjected
to ammonium sulphate precipitation (starting with 10%
followed by 30% and finally 50%). The pellet after the
50% ammonium sulphate cut was resuspended in buffer H/0.0
(no salt) and then dialyzed overnight against buffer
H/0.15. The dialyzed sample was then bound to GST beads
(Sigma) and washed three times with buffer H*/0.15
(containing 150 mM NaCl instead of 150 mM KCl). Proteins
were eluted using reduced glutathione elution buffer (50
mM Tris.Cl, pH 8.0, 20 mM reduced glutathione, 0.01%
Nonidet P-40, 100 mM NaCl).
Immunoblotting and Silver stain
Anti-GST polyclonal antibodies were purchased from
Santa Cruz Biotechnologies. Western blotting technique
was carried out using standard protocol. The silver stain
protocol is described elsewhere [ 27 ] .
Gel retardation assay
Gel retardation assay was performed with slight
modification of the protocol used by Mukhopadhyay et al [
28 ] . The DNA fragments to be used for gel retardation
assay were endlabeled with γ 32P ATP. The binding
reactions were performed in 20 μl of T buffer (50 mM
Tris-HCl, pH 7.4, 50 mM KCl, 50 mM NaCl, 10 mM MgCl
2 , 0.1 mM EDTA, 0.5 mM DTT, 30 μg/ml
BSA) supplemented with 5 mM ATP and 6% (v/v) glycerol for
most of the reactions. The mixture was incubated at 37°C
for 10 min and loaded directly on a 5% polyacrylamide gel
in TBE buffer (89 mM Tris base, 89 mM boric acid, 2.5 mM
EDTA, pH 8.3). The gel was run at 150 V for 2 hours,
dried and autoradiographed.
Copper-phenanthroline footprint assay
The Copper-phenanthroline footprint assay was
performed essentially by using the protocol described by
Kuwabara et al [ 29 ] . The DNA-protein gel is run in the
absence of free radical scavengers as described in gel
retardation assay. The gel is placed in 200 ml of 50 mM
Tris-HCl, pH 8.0. The gel is further incubated for 10
minutes in a solution containing equal volume of solution
A (40 mM 1,10 Phenanthroline monohydrate in 100% EtOH and
9 mM Cupric sulphate mixed with equal volume followed by
1:10 dilution with water) and solution B (0.5%
3-Merceptopropionic acid in water). Finally the gel is
soaked in solution C (28 mM 2,9 Dimethyl-1,10
Phenanthroline in 100% EtOH) for 2 min. The gel is washed
twice in deionised water. After the pre-treatment of the
gel, it is autoradiographed and the retarded band is cut
from the gel and placed in an eppendorf tube. The DNA is
eluted from the gel slice, denatured and loaded in a
sequencing gel. The sequencing gel is fixed, dried and
the bands were visualised by autoradiography.
Authors' contributions
SKD designed, performed and co-ordinated the whole
study. NM participated in insect cell culture and helped in
making and amplification of baculovirus expressing GST-Cdc6
and GST. RKS helped in making the figures and drafting the
manuscript. GM helped in analysing the data and critically
reviewed the manuscript. All authors read and approved the
final manuscript.
