20 - Functions II - passing arguments.ipynb

Kernel: Python 3 (system-wide)

Exercise 20.1

Write a function called reverse_string() which prints the reverse of a string passed to it.

The call to the function is already included in the following code cell. You just need to write the function.

• Hint: See Notebook 6 for how to reverse a string

def reverse_string(s):
    '''Print reverse of string'''
    print(s[::-1])

reverse_string( 'ebmoG fo seeznapmihc ehT' )

Exercise 20.2

Write a function called average() that takes a list as an argument and prints out the average values in the list.

• Hint: See Task 3.10 if you have forgotten how to calculate the average of a list of values.

arriving_penguins = [10, 156, 73, 376, 786, 432, 1035, 901, 1102, 2567, 1571, 916, 1560, 632, 943, 246, 654, 1456, 504, 632]

def average(x):
    '''Average of a list of numbers'''
    print( sum(x)/len(x) )

average( arriving_penguins )

Exercise 20.3

Write a function called multiply_two_numbers() that prints the product of two number passed to it.

def multiply_two_numbers(n1, n2):
    '''Product of two numbers'''
    print(n1*n2)

n1 = float(input('Enter a number: '))
n2 = float(input('Enter another number: '))

multiply_two_numbers( n1, n2 )

Exercise 20.4

Write a function called count_bases() that takes two arguments. The first argument is a DNA sequence and the second is a string of the bases to be counted. If the second argument is missing then all bases should be counted.

The function should print the count of the specified bases.

• Hint: Reuse the code in Notebook 13 on Nested loops

dna_seq = 'ACGCGCAGATAGGACGCAGGGAGGGAGGAGGTTTTAGAAGAGGATAGACCCA'

def count_bases(dna_seq, bases='ACGT'):
    '''Count the frequency of each base specfied in bases in dna_seq.
    If no bases are given count all four bases.'''

    # Print the DNA sequence.
    print(dna_seq)

    # Loop through each base in bases.
    for base in bases:

        # Count the number of occurrences of the current base in the DNA sequence.
        count_base = dna_seq.count(base)

        if count_base == 1:
            # If there is a single occurrence of the current base print this:
            print( f'There is {count_base} "{base}"' )
        else:
            # Otherwise there are no, or more than one, occurrences so print this:
            print( f'There are {count_base} "{base}"s' )

count_bases(dna_seq, 'A')
count_bases(dna_seq, 'AT')
count_bases(dna_seq)