20 - Functions II - passing arguments.ipynb

Kernel: Python 3 (system-wide)

Exercise 20.1

Write a function called reverse_string() which prints the reverse of a string passed to it.

The call to the function is already included in the following code cell. You just need to write the function.

• Hint: See Notebook 6 for how to reverse a string

def reverse_string(string):
    print(string[::-1])
    
reverse_string( 'ebmoG fo seeznapmihc ehT' )

The chimpanzees of Gombe

Exercise 20.2

Write a function called average() that takes a list as an argument and prints out the average values in the list.

• Hint: See Task 3.10 if you have forgotten how to calculate the average of a list of values.

def average(list):
    average = 0
    sum = 0
    for i in list:
        sum += i
        average = sum/len(list)
        
    print(average)



arriving_penguins = [10, 156, 73, 376, 786, 432, 1035, 901, 1102, 2567, 1571, 916, 1560, 632, 943, 246, 654, 1456, 504, 632]

average( arriving_penguins )

827.6

Exercise 20.3

Write a function called multiply_two_numbers() that prints the product of two number passed to it.

def multiply_two_numbers(one, two):
    sum = one * two
    print(sum)


n1 = float(input('Enter a number: '))
n2 = float(input('Enter another number: '))

multiply_two_numbers( n1, n2 )

Enter a number: 

Enter another number: 

10.0

Exercise 20.4

Write a function called count_bases() that takes two arguments. The first argument is a DNA sequence and the second is a string of the bases to be counted. If the second argument is missing then all bases should be counted.

The function should print the count of the specified bases.

• Hint: Reuse the code in Notebook 13 on Nested loops

def count_bases(one, two=''):
    count = 0
    if two == '':
        count = len(one)
    else:
        count = one.count(two)
            
    print(count)
            


dna_seq = 'ACGCGCAGATAGGACGCAGGGAGGGAGGAGGTTTTAGAAGAGGATAGACCCA'

count_bases(dna_seq, 'A')
count_bases(dna_seq, 'AT')
count_bases(dna_seq)

17
2
52

count_bases(dna_seq, 'A')
count_bases(dna_seq, 'AT')
count_bases(dna_seq)